pTargeT Sequencing Primer, 2microg Item ID: PMQ4461

sequencing primer,expression vector,q446

Designed for sequencing inserts in the pTARGET Vector.

The pTARGET Sequencing Primer is designed for sequencing inserts cloned into the pTARGET Mammalian Expression Vector (Cat.# A1410). This sequencing primer hybridizes to the region of the lacZ gene at nucleotides 1367-1344 on the pTARGET Vector. This primer can be used only for sequencing inserts in the pTARGET Vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The sequence of the pTARGET Sequencing Primer is 5'-d(TTACGCCAAGTTATTTAGGTGACA)-3'. It is supplied at a concentration of 10ng/ul (1.25pmol/ul) in sterile water.